Sample ID: VE25-1428_16S
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:04 |
| Analysis completed | 2025-05-03 01:28:04 |
| Wall time | 0:0:0 hours |
Trogoderma granarium
Outcome: Positive species identification.
Reasoning: [Flag 1A] 1 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | True |
|
Flag 7A: Identified species is consistent with preliminary morphology ID Trogoderma. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
| Coverage of Trogoderma | |
| Coverage of species in genus Trogoderma | |
| Coverage of species in genus Trogoderma in country of origin Pakistan |
Flag 5.1C:
The reference data are likely to be unreliable for this species
Reasoning: The given locus for this taxon is not present in reference database (0 entries)
There are 0 sequences in the reference database for Trogoderma at the given locus 16S mitochondrial rRNA gene.
Global occurrence records for Trogoderma.
Note that the occurrence data are not exhaustive, and it is possible for this species to occur in regions not shown on the map.
Flag 5.2C:
The reference data offers little support for species in this genus
Reasoning: ≤10% of taxon have reference sequence(s) at the given locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 16S mitochondrial rRNA gene
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
Reasoning: Not all species in genus from the country of origin have reference sequence(s) for this locus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 16S mitochondrial rRNA gene
| Taxa of interest detected? | True |
|
Flag 2A: Taxon of interest detected in candidate species Flag 5.1C: The given locus for this taxon is not present in reference database (0 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
| Locus | 16S mitochondrial rRNA gene |
| Preliminary ID | Trogoderma |
| Taxa of interest |
Trogoderma granarium |
| Country | Pakistan |
| Host | Rice |
| Sample ID | VE25-1428_16S |
| Query DNA sequence |
>VE25-1428_16S CAATCTCTCCTTTCGATAAGAACTCTCTAGAAGAATTACGCTGTTATCCCTAAGGTAATT TAATCTTATAATCACAAGATGGATCATCTAATCATAAATCAATGTTTCAATAAAAGAAAA GTTAAATAAATTTTCTAGTCACCCCAACCAAATTAACCTAAAATTGAAAATTTCTATACT AACAATTTAACAATTAAAGAAATAATAAAACTCTATAGGGTCTTCTCGTCTTTTAAAAAA ATTTGAGCCTTTTAACTCAAAAGTAAAATTCATCAAAATAAAAAAGAGACAGTGATCATT TCGTCCAACCATTCATTCCAGTTCCCAATAAAGAAACTAATTATTATGCTACCTTCGCAC AGTCAAAATACTGCGGCTCTTAAAATCAATCAGGGAGCAGGCTAGACCTTATATAAAACC AAAAGGA
Flag 1A:
Positive species identification
-
Trogoderma granarium
1 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 14 | 1 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Trogoderma granarium | 14 | 100.0% | 0.0 |
Database coverage of Candidate Trogoderma granariumThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Trogoderma granarium
Flag 5.1C:
The reference data are likely to be unreliable for this species
0 records
There are 0 sequences in the reference database for Trogoderma granarium at the given locus 16S mitochondrial rRNA gene.
Global occurrence records for Trogoderma granarium.
Database coverage of species in genus Trogoderma
Flag 5.2C:
The reference data offers little support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 16S mitochondrial rRNA gene Database coverage of species in genus Trogoderma that occur in country of origin Pakistan
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 16S mitochondrial rRNA gene |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | MZ571637 | Trogoderma granarium voucher DA336226 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 427 | 100.0% | 846.918 | 0.00e+00 | 100.0% |
| 2 | KJ930431 | Trogoderma granarium isolate der33 16S ribosomal RNA gene, partial sequence; mitochondrial | 417 | 97.7% | 827.096 | 0.00e+00 | 100.0% |
| 3 | MZ571636 | Trogoderma granarium voucher DA335997 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 427 | 100.0% | 838.989 | 0.00e+00 | 99.8% |
| 4 | KJ930432 | Trogoderma granarium isolate der38 16S ribosomal RNA gene, partial sequence; mitochondrial | 417 | 97.7% | 819.167 | 0.00e+00 | 99.8% |
| 5 | OM388538 | Trogoderma granarium isolate NNM37 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 393 | 92.0% | 771.592 | 0.00e+00 | 99.7% |
| 6 | KJ930487 | Trogoderma granarium isolate der226 16S ribosomal RNA gene, partial sequence; mitochondrial | 352 | 82.4% | 690.32 | 0.00e+00 | 99.7% |
| 7 | MN535884 | Trogoderma granarium isolate TR1 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 248 | 58.1% | 484.164 | 6.11e-132 | 99.6% |
| 8 | LC386208 | Trogoderma granarium mitochondrial DNA, contig: 140401 T. granarium Contig1 | 427 | 100.0% | 831.06 | 0.00e+00 | 99.5% |
| 9 | ON725093 | Trogoderma granarium isolate 1RC large subunit ribosomal RNA gene, partial sequence; mitochondrial | 427 | 100.0% | 831.06 | 0.00e+00 | 99.5% |
| 10 | NC_053875 | Trogoderma granarium mitochondrion, complete genome | 427 | 100.0% | 831.06 | 0.00e+00 | 99.5% |
| 11 | KJ930452 | Trogoderma granarium isolate der88 16S ribosomal RNA gene, partial sequence; mitochondrial | 417 | 97.7% | 811.238 | 0.00e+00 | 99.5% |
| 12 | KJ930433 | Trogoderma granarium isolate der39 16S ribosomal RNA gene, partial sequence; mitochondrial | 417 | 97.7% | 811.238 | 0.00e+00 | 99.5% |
| 13 | OM389182 | Trogoderma granarium isolate NNM57 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 392 | 91.8% | 761.681 | 0.00e+00 | 99.5% |
| 14 | OM388512 | Trogoderma granarium isolate nnm6 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 383 | 89.7% | 743.841 | 0.00e+00 | 99.5% |
| 15 | MW911680 | Trogoderma granarium isolate 1594 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 208 | 48.7% | 404.874 | 4.52e-108 | 99.5% |
| 16 | OM388567 | Trogoderma granarium isolate partial 46 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 393 | 92.0% | 755.734 | 0.00e+00 | 99.2% |
| 17 | OM389131 | Trogoderma granarium isolate partial 14 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 392 | 91.8% | 753.752 | 0.00e+00 | 99.2% |
| 18 | MW911673 | Trogoderma granarium isolate 1610 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 208 | 48.7% | 396.945 | 1.10e-105 | 99.0% |
| 19 | MW911674 | Trogoderma granarium isolate 1609 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 205 | 48.0% | 390.998 | 6.79e-104 | 99.0% |
| 20 | MW911689 | Trogoderma granarium isolate 1631 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 182 | 42.6% | 345.406 | 3.60e-90 | 98.9% |
| 21 | MW911686 | Trogoderma granarium isolate 1583 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 208 | 48.7% | 389.016 | 2.68e-103 | 98.6% |
| 22 | MW049034 | Trogoderma granarium strain TR4 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 211 | 49.4% | 392.98 | 1.72e-104 | 98.1% |
| 23 | MW911679 | Trogoderma granarium isolate 1598 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 208 | 48.7% | 381.087 | 6.54e-101 | 98.1% |
| 24 | MW049033 | Trogoderma granarium strain TR5 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 211 | 49.4% | 381.087 | 6.54e-101 | 97.6% |
| 25 | MZ571638 | Trogoderma glabrum voucher VAITC10096 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 427 | 100.0% | 638.781 | 1.75e-178 | 93.9% |
| 26 | KJ930458 | Trogoderma glabrum isolate der105 16S ribosomal RNA gene, partial sequence; mitochondrial | 417 | 97.7% | 618.958 | 1.62e-172 | 93.8% |
| 27 | KJ930508 | Trogoderma glabrum isolate der259 16S ribosomal RNA gene, partial sequence; mitochondrial | 401 | 93.9% | 595.171 | 2.34e-165 | 93.8% |
| 28 | KJ930513 | Trogoderma okumurai isolate der278 16S ribosomal RNA gene, partial sequence; mitochondrial | 251 | 58.8% | 361.756 | 4.31e-95 | 93.2% |
| 29 | NC_084300 | Pteroptyx asymmetria voucher KU-2015-15-Pa05 mitochondrion, complete genome | 206 | 48.2% | 298.3235 | 5.37e-76 | 93.2% |
| 30 | KJ930502 | Trogoderma okumurai isolate der249 16S ribosomal RNA gene, partial sequence; mitochondrial | 251 | 58.8% | 353.827 | 1.05e-92 | 92.8% |
| 31 | PP474521 | Anthrenus pimpinellae voucher P3 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 218 | 51.1% | 308.2346 | 5.58e-79 | 92.7% |
| 32 | DQ371181 | Luciola sp. KIZ-F194 16S ribosomal RNA gene, partial sequence; mitochondrial | 202 | 47.3% | 282.4655 | 3.19e-71 | 92.6% |
| 33 | PP474524 | Anthrenus pimpinellae voucher P8 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 220 | 51.5% | 304.2706 | 8.70e-78 | 92.4% |
| 34 | AB436499 | Luciola kuroiwae mitochondrial gene for 16S rRNA, partial sequence, isolate: 07507C_a | 199 | 46.6% | 268.5895 | 4.79e-67 | 92.0% |
| 35 | AB671254 | Luciola kuroiwae mitochondrial gene for 16S rRNA, partial sequence, specimen_voucher: personal: Masahiko Muraji: KR062 | 199 | 46.6% | 268.5895 | 4.79e-67 | 92.0% |
| 36 | MH447231 | Pteroptyx tener voucher ST09 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 37 | MH447200 | Pteroptyx tener voucher KF19 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 38 | MH447205 | Pteroptyx tener voucher KF25 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 39 | MT140361 | Pteroptyx tener isolate kf40 mitochondrion | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 40 | MH447176 | Pteroptyx tener voucher KD02 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 41 | MH447228 | Pteroptyx tener voucher ST02 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 42 | MH447188 | Pteroptyx tener voucher KD15 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 43 | MH447185 | Pteroptyx tener voucher KD12 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 44 | OP747322 | Pteroptyx tener voucher KU-2015-15-Pt06 mitochondrion, complete genome | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 45 | MH447175 | Pteroptyx tener voucher KD01 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 46 | MH447221 | Pteroptyx tener voucher KF56 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 47 | MH447201 | Pteroptyx tener voucher KF20 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 48 | MT140358 | Pteroptyx tener isolate kf36 mitochondrion | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 49 | MH447229 | Pteroptyx tener voucher ST04 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 50 | MH447233 | Pteroptyx tener voucher ST11 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 51 | MH447197 | Pteroptyx tener voucher KF16 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 52 | MH447184 | Pteroptyx tener voucher KD11 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 53 | MH447234 | Pteroptyx tener voucher ST15 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 54 | MH447177 | Pteroptyx tener voucher KD03 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 55 | MH447219 | Pteroptyx tener voucher KF53 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 56 | MH447181 | Pteroptyx tener voucher KD07 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 57 | MH447214 | Pteroptyx tener voucher KF34 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 58 | MH447225 | Pteroptyx tener voucher KF63 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 59 | MH447194 | Pteroptyx malaccae voucher KF12 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 60 | MT140359 | Pteroptyx tener isolate kf37 mitochondrion | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 61 | MH447236 | Pteroptyx tener voucher ST18 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 62 | MH447230 | Pteroptyx tener voucher ST06 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 63 | MH447206 | Pteroptyx tener voucher KF26 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 64 | MT140360 | Pteroptyx tener isolate kf38 mitochondrion | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 65 | MH447215 | Pteroptyx tener voucher KF41 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 66 | MH447187 | Pteroptyx tener voucher KD14 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 67 | MH447220 | Pteroptyx tener voucher KF54 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 68 | MH447186 | Pteroptyx tener voucher KD13 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 69 | MH447189 | Pteroptyx tener voucher KD16 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 70 | MH447216 | Pteroptyx tener voucher KF48 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 71 | MH447211 | Pteroptyx tener voucher KF31 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 72 | MH447192 | Pteroptyx tener voucher KF10 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 73 | MH447213 | Pteroptyx tener voucher KF33 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 74 | MH447190 | Pteroptyx tener voucher KF08 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 75 | MH447209 | Pteroptyx tener voucher KF29 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 76 | MH447218 | Pteroptyx tener voucher KF51 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 77 | MH447204 | Pteroptyx tener voucher KF24 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 78 | MH447183 | Pteroptyx tener voucher KD09 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 79 | MH447178 | Pteroptyx tener voucher KD04 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 80 | MH447222 | Pteroptyx tener voucher KF57 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 81 | NC_067972 | Pteroptyx tener mitochondrion, complete genome | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 82 | MH447227 | Pteroptyx tener voucher ST01 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 83 | MH447208 | Pteroptyx tener voucher KF28 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 84 | MH447210 | Pteroptyx tener voucher KF30 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 85 | MH447235 | Pteroptyx tener voucher ST16 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 86 | MH447232 | Pteroptyx tener voucher ST10 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 87 | MH447202 | Pteroptyx tener voucher KF21 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 88 | MH447217 | Pteroptyx tener voucher KF50 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 89 | MH447226 | Pteroptyx tener voucher KF64 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 90 | MH447191 | Pteroptyx tener voucher KF09 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 91 | MH447193 | Pteroptyx tener voucher KF11 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 92 | MH447223 | Pteroptyx tener voucher KF58 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 93 | MH447212 | Pteroptyx tener voucher KF32 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 94 | MH447179 | Pteroptyx tener voucher KD05 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 95 | MH447203 | Pteroptyx tener voucher KF22 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 96 | MH447195 | Pteroptyx malaccae voucher KF13 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 97 | MH447182 | Pteroptyx tener voucher KD08 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 98 | MH447196 | Pteroptyx tener voucher KF14 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 99 | MH447199 | Pteroptyx tener voucher KF18 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 100 | MH447207 | Pteroptyx tener voucher KF27 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 101 | MH447198 | Pteroptyx tener voucher KF17 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 102 | MH447180 | Pteroptyx tener voucher KD06 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 216 | 50.6% | 286.4305 | 2.04e-72 | 91.7% |
| 103 | LC677171 | Luciola parvula 1194M mitochondrial DNA, complete genome | 203 | 47.5% | 268.5897 | 4.79e-67 | 91.7% |
| 104 | PP474522 | Anthrenus pimpinellae voucher P10 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 244 | 57.1% | 318.14660000000003 | 5.79e-82 | 91.5% |
| 105 | EF143221 | Lampyridae sp. UPOL ZL2011 16S ribosomal RNA gene, partial sequence; mitochondrial | 199 | 46.6% | 260.6607 | 1.17e-64 | 91.5% |
| 106 | PP474523 | Anthrenus pimpinellae voucher P9 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 248 | 58.1% | 318.14660000000003 | 5.79e-82 | 91.2% |
| 107 | NC_084301 | Pteroptyx malaccae voucher KU-2012-06-24 mitochondrion, complete genome | 212 | 49.6% | 270.57169999999996 | 1.21e-67 | 91.1% |
| 108 | AB436501 | Luciola sp. 07720D-Tsp1 mitochondrial gene for 16S rRNA, partial sequence | 217 | 50.8% | 272.5542 | 3.07e-68 | 90.8% |
| 109 | AB436504 | Luciola parvula mitochondrial gene for 16S rRNA, partial sequence, isolate: 06610A_a | 170 | 39.8% | 210.612 | 1.36e-49 | 90.6% |
| 110 | AB009909 | Hotaria parvula mitochondrial DNA for 16S rRNA, partial sequence | 199 | 46.6% | 244.8027 | 6.94e-60 | 90.5% |
| 111 | KJ405003 | Dilophotes sp. P LB-2014 voucher UPOL TH0114 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 227 | 53.2% | 276.5188 | 1.97e-69 | 90.4% |
| 112 | KJ404914 | Dilophotes sp. P LB-2014 voucher UPOL TH0014 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 227 | 53.2% | 276.5188 | 1.97e-69 | 90.4% |
| 113 | AB009907 | Luciola kuroiwae mitochondrial DNA for 16S rRNA, partial sequence | 215 | 50.4% | 260.6605 | 1.17e-64 | 90.3% |
| 114 | KC538737 | Xylobanus sp. UPOL A00053 voucher UPOLA00053 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 213 | 49.9% | 256.6962 | 1.82e-63 | 90.2% |
| 115 | MH447224 | Pteroptyx tener voucher KF61 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 242 | 56.7% | 290.395 | 1.31e-73 | 90.1% |
| 116 | KT752043 | Lycoprogenthes sp. UPOL A00545 16S ribosomal RNA gene, partial sequence; mitochondrial | 199 | 46.6% | 236.87339999999998 | 1.69e-57 | 90.0% |
| 117 | KF626012 | Phengodes sp. UPOL 001241 16S ribosomal RNA gene, partial sequence; mitochondrial | 212 | 49.6% | 242.82049999999998 | 2.74e-59 | 89.8% |
| 118 | NC_010969 | Rhagophthalmus lufengensis mitochondrion, complete genome | 177 | 41.5% | 200.701 | 1.31e-46 | 89.4% |
| 119 | MK468080 | Cautires pahangensis voucher UPOL VK0527 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 226 | 52.9% | 258.6782 | 4.62e-64 | 89.4% |
| 120 | KF755272 | Enochrus quadripunctatus voucher IBE| 139 |
32.6% |
159.073 |
4.45e-34 |
89.4% |
|
| 121 | KF294756 | Eurypogon hisamatsui voucher UPOL RK0128 16S ribosomal RNA gene, partial sequence; mitochondrial | 237 | 55.5% | 266.6078 | 1.89e-66 | 89.3% |
| 122 | MF288246 | Trichalus sp. BM0133 voucher UPOL:BM0133 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 205 | 48.0% | 232.90900000000002 | 2.64e-56 | 89.3% |
| 123 | KF294757 | Eurypogon brevipennis voucher UPOL 001335 16S ribosomal RNA gene, partial sequence; mitochondrial | 237 | 55.5% | 266.6078 | 1.89e-66 | 89.2% |
| 124 | OZ020231 | Aphodius granarius genome assembly, organelle: mitochondrion | 173 | 40.5% | 194.754 | 8.08e-45 | 89.1% |
| 125 | DQ180996 | Lycoprogenthes sp. UPOL 000358 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 200 | 46.8% | 222.9977 | 2.54e-53 | 89.1% |
| 126 | KT752031 | Lycoprogenthes sp. UPOL A00532 16S ribosomal RNA gene, partial sequence; mitochondrial | 200 | 46.8% | 222.9977 | 2.54e-53 | 89.1% |
| 127 | KT752142 | Eurrhacini sp. UPOL A00648 16S ribosomal RNA gene, partial sequence; mitochondrial | 239 | 56.0% | 260.6607 | 1.17e-64 | 88.8% |
| 128 | KT447366 | Oestodes tenuicollis voucher UPOL:RK0796 16S ribosomal RNA gene, partial sequence; mitochondrial | 173 | 40.5% | 186.825 | 1.97e-42 | 88.8% |
| 129 | LT905438 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad26 region, specimen voucher IBE-SP43 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 130 | LT905436 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad24 region, specimen voucher IBE-SP48 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 131 | LT905440 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad28 region, specimen voucher IBE-SP46 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 132 | LT905439 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad27 region, specimen voucher IBE-SP45 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 133 | LT905437 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad25 region, specimen voucher IBE-SP8 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 134 | LT905434 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad22 region, specimen voucher IBE-SP29 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 135 | LT905435 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad23 region, specimen voucher IBE-SP49 | 139 | 32.6% | 153.126 | 2.75e-32 | 88.8% |
| 136 | JN581765 | Zyras perdecoratus voucher ZMUN:10051273 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 212 | 49.6% | 230.92680000000001 | 1.04e-55 | 88.7% |
| 137 | JN581764 | Zyras perdecoratus voucher ZMUN:10051274 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 212 | 49.6% | 230.92680000000001 | 1.04e-55 | 88.7% |
| 138 | LT905430 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad18 region, specimen voucher IBE-SP31 | 139 | 32.6% | 151.144 | 1.08e-31 | 88.7% |
| 139 | MT872706 | Aphodius pedellus isolate DM644 mitochondrion, partial genome | 268 | 62.8% | 290.3947 | 1.31e-73 | 88.6% |
| 140 | KY495952 | Dorylogaster sp. JP-2017 16S ribosomal RNA gene, partial sequence; mitochondrial | 228 | 53.4% | 246.7849 | 1.76e-60 | 88.6% |
| 141 | KJ661630 | Macrolycus sp. B YL-2014 voucher UPOL YL0386 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 217 | 50.8% | 234.8913 | 6.68e-57 | 88.6% |
| 142 | NC_010964 | Rhagophthalmus ohbai mitochondrion, complete genome | 208 | 48.7% | 224.98020000000002 | 6.43e-54 | 88.6% |
| 143 | AB009931 | Rhagophthalmus ohbai mitochondrial DNA for 16S rRNA, partial sequence | 208 | 48.7% | 224.98020000000002 | 6.43e-54 | 88.6% |
| 144 | KT752029 | Lycoprogenthes sp. UPOL A00530 16S ribosomal RNA gene, partial sequence; mitochondrial | 200 | 46.8% | 215.0687 | 6.20e-51 | 88.6% |
| 145 | KT752119 | Eurrhacini sp. UPOL A00622 16S ribosomal RNA gene, partial sequence; mitochondrial | 239 | 56.0% | 254.7137 | 7.21e-63 | 88.5% |
| 146 | EF487991 | Aphodius fimetarius voucher BMNH 703033 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 265 | 62.1% | 284.4477 | 8.07e-72 | 88.5% |
| 147 | JN097777 | Priobium sericeum 16S ribosomal RNA gene, partial sequence; mitochondrial | 253 | 59.3% | 268.5894 | 4.80e-67 | 88.5% |
| 148 | MK468078 | Cautires sp. UPOL AJ0036 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 226 | 52.9% | 242.8202 | 2.74e-59 | 88.5% |
| 149 | MK468070 | Cautires sp. UPOL AJ0012 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 246 | 57.6% | 260.6602 | 1.17e-64 | 88.4% |
| 150 | MK468076 | Cautires sp. UPOL AJ0075 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 246 | 57.6% | 260.6602 | 1.17e-64 | 88.4% |
| 151 | KC538647 | Cautires sp. UPOL 000070 voucher UPOL000070 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 246 | 57.6% | 260.6602 | 1.17e-64 | 88.4% |
| 152 | MK468077 | Cautires sp. UPOL VK0531 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 246 | 57.6% | 260.6602 | 1.17e-64 | 88.4% |
| 153 | PP958231 | Agathidium sp. isolate AMZS4 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 230 | 53.9% | 244.803 | 6.94e-60 | 88.4% |
| 154 | KF626061 | Eurypogon japonicus voucher UPOL 001336 16S ribosomal RNA gene, partial sequence; mitochondrial | 237 | 55.5% | 250.7498 | 1.12e-61 | 88.3% |
| 155 | KJ404968 | Dilophotes sp. E LB-2014 voucher UPOL TH0079 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 205 | 48.0% | 217.0507 | 1.57e-51 | 88.3% |
| 156 | MK468068 | Cautires nervosus voucher UPOL AJ0085 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 234 | 54.8% | 242.8202 | 2.74e-59 | 88.2% |
| 157 | MK468062 | Cautires nervosus voucher UPOL VK0621 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 233 | 54.6% | 240.838 | 1.08e-58 | 88.2% |
| 158 | MK468064 | Cautires nervosus voucher UPOL VK0533 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 234 | 54.8% | 242.8202 | 2.74e-59 | 88.2% |
| 159 | MK468067 | Cautires nervosus voucher UPOL AJ0080 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 234 | 54.8% | 242.8202 | 2.74e-59 | 88.2% |
| 160 | MK468066 | Cautires nervosus voucher UPOL AJ0065 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 234 | 54.8% | 242.8202 | 2.74e-59 | 88.2% |
| 161 | MK468069 | Cautires nervosus voucher UPOL VK0270 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 234 | 54.8% | 242.8202 | 2.74e-59 | 88.2% |
| 162 | MK468060 | Cautires nervosus voucher UPOL AJ0010 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 233 | 54.6% | 240.838 | 1.08e-58 | 88.2% |
| 163 | KF626043 | Lissominae sp. UPOL RK0335 16S ribosomal RNA gene, partial sequence; mitochondrial | 202 | 47.3% | 211.1037 | 9.68e-50 | 88.2% |
| 164 | KT752134 | Eurrhacini sp. UPOL A00638 16S ribosomal RNA gene, partial sequence; mitochondrial | 231 | 54.1% | 238.85569999999998 | 4.28e-58 | 88.1% |
| 165 | KT752040 | Lycoprogenthes sp. UPOL A00542 16S ribosomal RNA gene, partial sequence; mitochondrial | 233 | 54.6% | 240.83819999999997 | 1.08e-58 | 88.1% |
| 166 | MK468079 | Cautires sp. UPOL VK0424 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 226 | 52.9% | 234.89120000000003 | 6.68e-57 | 88.1% |
| 167 | KT752060 | Flagrax sp. UPOL A00562 16S ribosomal RNA gene, partial sequence; mitochondrial | 209 | 48.9% | 215.06900000000002 | 6.20e-51 | 88.1% |
| 168 | DQ371178 | Luciola kuroiwae 16S ribosomal RNA gene, partial sequence; mitochondrial | 303 | 71.0% | 306.253 | 2.20e-78 | 87.9% |
| 169 | KC538645 | Cautires sp. UPOL 000068 voucher UPOL000068 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 179 | 41.9% | 180.878 | 1.21e-40 | 87.8% |
| 170 | KU495980 | Lygistopterus sp. UPOL MT0038 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 170 | 39.8% | 172.949 | 2.96e-38 | 87.8% |
| 171 | KT752064 | Flagrax sp. UPOL A00566 16S ribosomal RNA gene, partial sequence; mitochondrial | 178 | 41.7% | 178.896 | 4.80e-40 | 87.7% |
| 172 | KF294755 | Eurypogon japonicus voucher UPOL RK0091 16S ribosomal RNA gene, partial sequence; mitochondrial | 233 | 54.6% | 232.9088 | 2.64e-56 | 87.7% |
| 173 | DQ180969 | Dihammatus sp. UPOL 000L12 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 225 | 52.7% | 224.98020000000002 | 6.43e-54 | 87.7% |
| 174 | KC185942 | Macrima sp. BMNH 846551 16S ribosomal RNA gene, partial sequence; mitochondrial | 218 | 51.1% | 221.0157 | 1.00e-52 | 87.7% |
| 175 | KJ661640 | Macrolycus sp. 7 YL-2014 voucher UPOL YL0421 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 217 | 50.8% | 219.03320000000002 | 3.97e-52 | 87.7% |
| 176 | EU030508 | Epactoides helenae voucher Ale.hel.24.2 16S ribosomal RNA gene, partial sequence; mitochondrial | 167 | 39.1% | 167.002 | 1.83e-36 | 87.6% |
| 177 | EU030507 | Epactoides helenae voucher Ale.hel.24.1 16S ribosomal RNA gene, partial sequence; mitochondrial | 167 | 39.1% | 167.002 | 1.83e-36 | 87.6% |
| 178 | HQ333717 | Ludioschema sp. UPOL RK0055 voucher UPOL:RK0055 16S ribosomal RNA gene, partial sequence; mitochondrial | 231 | 54.1% | 228.94480000000001 | 4.12e-55 | 87.6% |
| 179 | KJ930455 | Trogoderma inclusum isolate der94 16S ribosomal RNA gene, partial sequence; mitochondrial | 413 | 96.7% | 404.874 | 4.52e-108 | 87.5% |
| 180 | MZ571643 | Trogoderma sp. VAITC9052 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 413 | 96.7% | 404.874 | 4.52e-108 | 87.5% |
| 181 | KJ661642 | Macrolycus sp. 11 YL-2014 voucher UPOL YL0199 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 230 | 53.9% | 228.94480000000001 | 4.12e-55 | 87.5% |
| 182 | KT752059 | Flagrax sp. UPOL A00561 16S ribosomal RNA gene, partial sequence; mitochondrial | 249 | 58.3% | 240.8377 | 1.08e-58 | 87.3% |
| 183 | DQ180980 | Flagrax sp. UPOL 000L26 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 249 | 58.3% | 240.8377 | 1.08e-58 | 87.3% |
| 184 | JN581772 | Zyras sp. prope perdecoratus HE-2012 voucher ZMUN:10051276 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 248 | 58.1% | 240.83780000000002 | 1.08e-58 | 87.3% |
| 185 | JN581773 | Zyras sp. prope perdecoratus HE-2012 voucher ZMUN:10051275 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 248 | 58.1% | 240.83780000000002 | 1.08e-58 | 87.3% |
| 186 | MK468063 | Cautires nervosus voucher UPOL AJ0076 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 233 | 54.6% | 224.98000000000002 | 6.43e-54 | 87.3% |
| 187 | KU495978 | Lygistopterus sp. UPOL MT0074 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 170 | 39.8% | 165.02 | 7.22e-36 | 87.3% |
| 188 | PP239566 | Trogoderma versicolor breed T4 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 413 | 96.7% | 394.962 | 4.35e-105 | 87.2% |
| 189 | PP239565 | Trogoderma versicolor breed T3 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 413 | 96.7% | 394.962 | 4.35e-105 | 87.2% |
| 190 | KU495990 | Lygistopterus sp. UPOL MT0080 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 178 | 41.7% | 170.967 | 1.17e-37 | 87.2% |
| 191 | KU495989 | Lygistopterus sp. UPOL MT0075 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 178 | 41.7% | 170.967 | 1.17e-37 | 87.2% |
| 192 | DQ180973 | Calochromus sp. UPOL 000L16 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 170 | 39.8% | 165.02 | 7.22e-36 | 87.2% |
| 193 | KJ661638 | Macrolycus sp. 10 YL-2014 voucher UPOL YL0208 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 217 | 50.8% | 211.1042 | 9.67e-50 | 87.2% |
| 194 | KJ661633 | Macrolycus mucronatus voucher UPOL DS0014 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 217 | 50.8% | 211.1042 | 9.67e-50 | 87.2% |
| 195 | KJ661616 | Macrolycus flabellatus voucher UPOL YL0032 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 196 | KJ661617 | Macrolycus montanus voucher UPOL YL0058 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 197 | KJ661618 | Macrolycus similaris voucher UPOL YL0019 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 198 | EF143217 | Macrolycus sp. UPOL ZL2005 16S ribosomal RNA gene, partial sequence; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 199 | KJ661614 | Macrolycus submontanus voucher UPOL YL0025 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 200 | KJ661621 | Macrolycus flabellatus voucher UPOL YL0272 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 201 | KJ661606 | Macrolycus submontanus voucher UPOL YL0016 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 202 | KJ661620 | Macrolycus kotuensis voucher UPOL YL0047 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 203 | KJ661612 | Macrolycus submontanus voucher UPOL YL0034 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 204 | KJ661619 | Macrolycus kleinei voucher UPOL YL0021 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 205 | KJ661613 | Macrolycus submontanus voucher UPOL YL0006 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 240.8377 | 1.08e-58 | 87.1% |
| 206 | MF288201 | Eniclases apertus voucher UPOL:BM0018 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 232 | 54.3% | 222.9978 | 2.54e-53 | 87.1% |
| 207 | KJ661561 | Macrolycus sp. C YL-2014 voucher UPOL YL0418 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 266 | 62.3% | 250.749 | 1.13e-61 | 87.0% |
| 208 | KU495988 | Lygistopterus sp. UPOL MT0061 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 191 | 44.7% | 180.878 | 1.21e-40 | 87.0% |
| 209 | KJ661641 | Macrolycus multicostatus voucher UPOL DS0011 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 227 | 53.2% | 215.0688 | 6.20e-51 | 86.9% |
| 210 | KJ661549 | Macrolycus dotatus voucher UPOL DS0004 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 270 | 63.2% | 252.7312 | 2.85e-62 | 86.8% |
| 211 | KJ661552 | Macrolycus dotatus voucher UPOL YL0143 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 270 | 63.2% | 252.7312 | 2.85e-62 | 86.8% |
| 212 | KJ661550 | Macrolycus dotatus voucher UPOL YL0185 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 270 | 63.2% | 252.7312 | 2.85e-62 | 86.8% |
| 213 | KJ661551 | Macrolycus dotatus voucher UPOL YL0186 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 270 | 63.2% | 252.7312 | 2.85e-62 | 86.8% |
| 214 | KT752062 | Flagrax sp. UPOL A00564 16S ribosomal RNA gene, partial sequence; mitochondrial | 270 | 63.2% | 250.74919999999997 | 1.13e-61 | 86.8% |
| 215 | KT752063 | Flagrax sp. UPOL A00565 16S ribosomal RNA gene, partial sequence; mitochondrial | 270 | 63.2% | 250.74919999999997 | 1.13e-61 | 86.8% |
| 216 | HQ381429 | Canthydrus guttula voucher BMNH792509 16S ribosomal RNA gene, partial sequence; mitochondrial | 203 | 47.5% | 186.825 | 1.97e-42 | 86.7% |
| 217 | KJ661629 | Macrolycus dominator ishigakianus voucher UPOL YL0256 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 244.8023 | 6.94e-60 | 86.7% |
| 218 | KJ661623 | Macrolycus sp. 3 YL-2014 voucher UPOL YL0194 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 244.8023 | 6.94e-60 | 86.7% |
| 219 | KJ661625 | Macrolycus sp. 3 YL-2014 voucher UPOL YL0403 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 244.8023 | 6.94e-60 | 86.7% |
| 220 | KJ661627 | Macrolycus dominator ishigakianus voucher UPOL YL0257 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 244.8023 | 6.94e-60 | 86.7% |
| 221 | KF626003 | Rhagophthalmidae sp. UPOL RK0088 16S ribosomal RNA gene, partial sequence; mitochondrial | 177 | 41.5% | 163.038 | 2.85e-35 | 86.7% |
| 222 | KJ930477 | Trogoderma simplex isolate der211 16S ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 335.495 | 3.47e-87 | 86.4% |
| 223 | KJ661554 | Macrolycus dotatus voucher UPOL YL0344 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 270 | 63.2% | 244.80220000000003 | 6.94e-60 | 86.4% |
| 224 | JN581701 | Amaurodera yaoana voucher ZMUC:10030812 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 307 | 71.9% | 272.5539 | 3.07e-68 | 86.3% |
| 225 | JN581700 | Amaurodera yaoana voucher ZMUC:10030878 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 307 | 71.9% | 272.5539 | 3.07e-68 | 86.3% |
| 226 | KJ661622 | Macrolycus nagaii voucher UPOL YL0071 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 224.9797 | 6.44e-54 | 86.3% |
| 227 | KJ661581 | Macrolycus sp. 12 YL-2014 voucher UPOL YL0233 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 236.87330000000003 | 1.69e-57 | 86.3% |
| 228 | KJ661578 | Macrolycus sp. 12 YL-2014 voucher UPOL A00463 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 236.87330000000003 | 1.69e-57 | 86.3% |
| 229 | KJ661580 | Macrolycus sp. 12 YL-2014 voucher UPOL YL0383 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 236.87330000000003 | 1.69e-57 | 86.3% |
| 230 | KJ661632 | Macrolycus alishanus voucher UPOL YL0442 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 236.87330000000003 | 1.69e-57 | 86.3% |
| 231 | KJ661631 | Macrolycus sp. A YL-2014 voucher UPOL YL0200 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 236.87330000000003 | 1.69e-57 | 86.3% |
| 232 | FJ903710 | Anthicidae sp. UPOL ZL0060 16S ribosomal RNA gene, partial sequence; mitochondrial | 202 | 47.3% | 178.896 | 4.80e-40 | 86.2% |
| 233 | KJ930507 | Trogoderma simplex isolate der254 16S ribosomal RNA gene, partial sequence; mitochondrial | 413 | 96.7% | 359.282 | 2.40e-94 | 86.1% |
| 234 | KJ510115 | Uloma opacipennis voucher LSOL.01360 16S ribosomal RNA gene, partial sequence; mitochondrial | 178 | 41.7% | 155.109 | 6.95e-33 | 86.1% |
| 235 | KJ510122 | Uloma opacipennis voucher LSOL.02237 16S ribosomal RNA gene, partial sequence; mitochondrial | 178 | 41.7% | 155.109 | 6.95e-33 | 86.1% |
| 236 | KJ930504 | Trogoderma sternale isolate der251 16S ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 321.619 | 5.22e-83 | 86.0% |
| 237 | KY055963 | Suphisellus curtus isolate SLE686 16S ribosomal RNA gene, partial sequence; mitochondrial | 178 | 41.7% | 155.109 | 6.95e-33 | 86.0% |
| 238 | KJ930461 | Trogoderma simplex isolate der118 16S ribosomal RNA gene, partial sequence; mitochondrial | 348 | 81.5% | 295.849 | 2.98e-75 | 85.9% |
| 239 | KJ661559 | Macrolycus atronotatus voucher UPOL A00465 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 267 | 62.5% | 228.94420000000002 | 4.12e-55 | 85.9% |
| 240 | KJ661649 | Macrolycus gracilis voucher UPOL TH0094 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 217.05100000000002 | 1.57e-51 | 85.9% |
| 241 | KJ404983 | Macrolycus sp. UPOL TH0094 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 253 | 59.3% | 217.05100000000002 | 1.57e-51 | 85.9% |
| 242 | KJ661587 | Macrolycus sp. 4 YL-2014 voucher UPOL YL0204 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 182.86 | 3.07e-41 | 85.7% |
| 243 | KJ661588 | Macrolycus sp. 4 YL-2014 voucher UPOL YL0210 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 182.86 | 3.07e-41 | 85.7% |
| 244 | KJ661577 | Macrolycus galinae voucher UPOL A00464 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 182.86 | 3.07e-41 | 85.7% |
| 245 | MW551232 | Micraspis discolor voucher JD-07.17a large subunit ribosomal RNA gene, partial sequence; mitochondrial | 187 | 43.8% | 157.091 | 1.76e-33 | 85.6% |
| 246 | KF755230 | Enochrus coarctatus voucher IBE| 256 |
60.0% |
206.647 |
2.12e-48 |
85.5% |
|
| 247 | KJ661593 | Macrolycus sp. 8 YL-2014 voucher UPOL YL0241 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 223 | 52.2% | 180.878 | 1.21e-40 | 85.4% |
| 248 | KJ930462 | Trogoderma grassmani isolate der131 16S ribosomal RNA gene, partial sequence; mitochondrial | 408 | 95.6% | 325.583 | 3.34e-84 | 85.3% |
| 249 | KJ930515 | Trogoderma sternale plagifer isolate der280 16S ribosomal RNA gene, partial sequence; mitochondrial | 407 | 95.3% | 323.601 | 1.32e-83 | 85.3% |
| 250 | KY055957 | Suphisellus simoni isolate SLE685 16S ribosomal RNA gene, partial sequence; mitochondrial | 183 | 42.9% | 149.162 | 4.29e-31 | 85.3% |
| 251 | KJ930460 | Trogoderma sternale sternale isolate der116 16S ribosomal RNA gene, partial sequence; mitochondrial | 408 | 95.6% | 323.601 | 1.32e-83 | 85.2% |
| 252 | KJ930467 | Trogoderma teukton isolate der177 16S ribosomal RNA gene, partial sequence; mitochondrial | 403 | 94.4% | 321.619 | 5.22e-83 | 85.2% |
| 253 | KJ930444 | Trogoderma variabile isolate der68 16S ribosomal RNA gene, partial sequence; mitochondrial | 407 | 95.3% | 321.619 | 5.22e-83 | 85.2% |
| 254 | KJ661605 | Macrolycus sp. 1 YL-2014 voucher UPOL YL0404 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 174.931 | 7.49e-39 | 85.2% |
| 255 | KJ661586 | Macrolycus bocakorum voucher UPOL YL0188 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 174.931 | 7.49e-39 | 85.2% |
| 256 | KJ661569 | Macrolycus pusillus voucher UPOL YL0201 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 174.931 | 7.49e-39 | 85.2% |
| 257 | KJ661592 | Macrolycus sp. 8 YL-2014 voucher UPOL YL0393 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 174.931 | 7.49e-39 | 85.2% |
| 258 | KJ661567 | Macrolycus pusillus voucher UPOL YL0138 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 174.931 | 7.49e-39 | 85.2% |
| 259 | KJ661590 | Macrolycus sp. 8 YL-2014 voucher UPOL YL0177 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 174.931 | 7.49e-39 | 85.2% |
| 260 | EF143226 | Macrolycus sp. UPOL ZL2017 16S ribosomal RNA gene, partial sequence; mitochondrial | 223 | 52.2% | 172.949 | 2.96e-38 | 85.0% |
| 261 | KJ661602 | Macrolycus excellens voucher UPOL YL0443 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 223 | 52.2% | 172.949 | 2.96e-38 | 85.0% |
| 262 | KF625986 | Platycis sp. UPOL 001366 16S ribosomal RNA gene, partial sequence; mitochondrial | 217 | 50.8% | 170.967 | 1.17e-37 | 85.0% |
| 263 | KT752061 | Flagrax sp. UPOL A00563 16S ribosomal RNA gene, partial sequence; mitochondrial | 285 | 66.7% | 222.998 | 2.54e-53 | 85.0% |
| 264 | KJ930469 | Trogoderma grassmani isolate der184 16S ribosomal RNA gene, partial sequence; mitochondrial | 408 | 95.6% | 309.725 | 1.98e-79 | 84.8% |
| 265 | KJ930475 | Trogoderma sternale sternale isolate der201 16S ribosomal RNA gene, partial sequence; mitochondrial | 383 | 89.7% | 295.849 | 2.98e-75 | 84.8% |
| 266 | KJ930501 | Trogoderma anthrenoides isolate der248 16S ribosomal RNA gene, partial sequence; mitochondrial | 351 | 82.2% | 262.151 | 4.16e-65 | 84.8% |
| 267 | KJ661584 | Macrolycus bocakorum voucher UPOL YL0435 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 268 | KJ661585 | Macrolycus bocakorum voucher UPOL YL0230 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 269 | KJ661604 | Macrolycus sp. 1 YL-2014 voucher UPOL YL0205 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 270 | KJ661576 | Macrolycus rubineus voucher UPOL YL0433 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 271 | KJ661575 | Macrolycus rubineus voucher UPOL YL0416 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 272 | KJ661582 | Macrolycus bocakorum voucher UPOL YL0018 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 273 | KJ661571 | Macrolycus sp. 6 YL-2014 voucher UPOL YL0202 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 167.002 | 1.83e-36 | 84.8% |
| 274 | MF974932 | Calomela curtisi voucher JAJ9 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 325 | 76.1% | 250.7494 | 1.13e-61 | 84.8% |
| 275 | KJ930472 | Trogoderma ornatum isolate der196 16S ribosomal RNA gene, partial sequence; mitochondrial | 405 | 94.8% | 301.796 | 4.84e-77 | 84.7% |
| 276 | MT571479 | Troglocharinus sendrai voucher IBE_AN491 large subunit ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 362 | 84.8% | 268.098 | 6.74e-67 | 84.6% |
| 277 | MT571478 | Troglocharinus sendrai voucher IBE_AN351 large subunit ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 362 | 84.8% | 268.098 | 6.74e-67 | 84.6% |
| 278 | MT571476 | Troglocharinus mercedesi voucher IBE_RA462 large subunit ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 362 | 84.8% | 268.098 | 6.74e-67 | 84.6% |
| 279 | MT571475 | Troglocharinus mercedesi voucher IBE_PB33 large subunit ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 362 | 84.8% | 266.115 | 2.66e-66 | 84.6% |
| 280 | KF755225 | Enochrus ater voucher IBE| 265 |
62.1% |
192.772 |
3.19e-44 |
84.6% |
|
| 281 | KJ930509 | Trogoderma sternale plagifer isolate der262 16S ribosomal RNA gene, partial sequence; mitochondrial | 407 | 95.3% | 299.814 | 1.91e-76 | 84.5% |
| 282 | KJ930476 | Trogoderma ornatum isolate der202 16S ribosomal RNA gene, partial sequence; mitochondrial | 405 | 94.8% | 293.867 | 1.18e-74 | 84.5% |
| 283 | KJ930499 | Trogoderma ornatum isolate der244 16S ribosomal RNA gene, partial sequence; mitochondrial | 405 | 94.8% | 293.867 | 1.18e-74 | 84.5% |
| 284 | MZ571639 | Trogoderma variabile voucher VAITC9461 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 370 | 86.7% | 272.062 | 4.32e-68 | 84.5% |
| 285 | KY495970 | Malaybergius aenictophilus 16S ribosomal RNA gene, partial sequence; mitochondrial | 334 | 78.2% | 244.80290000000002 | 6.94e-60 | 84.5% |
| 286 | LC801634 | Enochrus simulans KNG_ar-y-1-18_CMG mitochondrial gene for 16S ribosomal RNA, partial sequence | 257 | 60.2% | 184.843 | 7.78e-42 | 84.4% |
| 287 | KY055954 | Suphisellus subsignatus isolate SLE692 16S ribosomal RNA gene, partial sequence; mitochondrial | 217 | 50.8% | 161.055 | 1.13e-34 | 84.4% |
| 288 | JN581757 | Pedinopleurus sp. HE-2012 voucher ZMUN:10051235 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 368 | 86.2% | 264.133 | 1.05e-65 | 84.3% |
| 289 | MT571468 | Stygiophyes puncticollis voucher IBE_RA932 large subunit ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 362 | 84.8% | 260.169 | 1.64e-64 | 84.3% |
| 290 | LN849364 | Stygiophyes zariquieyi genomic DNA containing rrnL-trnL-nad1 region, specimen voucher IBE-AF187 | 362 | 84.8% | 260.169 | 1.64e-64 | 84.3% |
| 291 | KJ661562 | Macrolycus venustus voucher UPOL YL0197 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 159.073 | 4.45e-34 | 84.3% |
| 292 | KJ661563 | Macrolycus venustus voucher UPOL YL0141 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 159.073 | 4.45e-34 | 84.3% |
| 293 | DQ180975 | Macrolycus sp. UPOL 000L18 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 220 | 51.5% | 159.073 | 4.45e-34 | 84.3% |
| 294 | KJ661594 | Macrolycus murzini voucher UPOL YL0014 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 220 | 51.5% | 159.073 | 4.45e-34 | 84.3% |
| 295 | KJ930465 | Trogoderma sternale isolate der175 16S ribosomal RNA gene, partial sequence; mitochondrial | 408 | 95.6% | 285.938 | 2.87e-72 | 84.2% |
| 296 | KJ930470 | Trogoderma fasciferum isolate der193 16S ribosomal RNA gene, partial sequence; mitochondrial | 375 | 87.8% | 270.08 | 1.71e-67 | 84.2% |
| 297 | JN581697 | Aloconota gregaria voucher ZMUN:10029294 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 344 | 80.6% | 244.31 | 9.76e-60 | 84.2% |
| 298 | PP474519 | Eurhopalus vespulae voucher RV1 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 415 | 97.2% | 289.902 | 1.84e-73 | 84.0% |
| 299 | KJ930505 | Trogoderma sternale aspericolle isolate der252 16S ribosomal RNA gene, partial sequence; mitochondrial | 380 | 89.0% | 264.133 | 1.05e-65 | 84.0% |
| 300 | KJ930473 | Trogoderma fasciferum isolate der199 16S ribosomal RNA gene, partial sequence; mitochondrial | 364 | 85.2% | 256.204 | 2.57e-63 | 84.0% |
| 301 | JN814894 | Enochrus bicolor isolate IBE-AB287 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 302 | JN814905 | Enochrus bicolor isolate IBE-AB59 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 303 | JN814899 | Enochrus bicolor isolate IBE-AB329 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 304 | JN814907 | Enochrus bicolor isolate IBE-AB7 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 305 | JN814901 | Enochrus bicolor isolate IBE-AB39 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 306 | JN814896 | Enochrus bicolor isolate IBE-AB29 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 307 | JN814880 | Enochrus bicolor isolate IBE-AB228 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 308 | JN814884 | Enochrus bicolor isolate IBE-AB232 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 84.0% |
| 309 | HG915701 | Speonomus sp. IR-2014 mitochondrial 16S rRNA gene (partial), tRNA-Leu gene and NAD1 gene (partial), specimen voucher IBE| 362 |
84.8% |
244.31 |
9.76e-60 |
84.0% |
|
| 310 | KY055955 | Suphisellus sp. 8 SMB-2016 isolate SLE839 16S ribosomal RNA gene, partial sequence; mitochondrial | 217 | 50.8% | 153.126 | 2.75e-32 | 84.0% |
| 311 | KJ930474 | Trogoderma fasciferum isolate der200 16S ribosomal RNA gene, partial sequence; mitochondrial | 375 | 87.8% | 262.151 | 4.16e-65 | 83.9% |
| 312 | JN814898 | Enochrus bicolor isolate IBE-AB328 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 248.275 | 6.25e-61 | 83.9% |
| 313 | KF755241 | Enochrus fuscipennis voucher IBE| 257 |
60.2% |
176.913 |
1.90e-39 |
83.9% |
|
| 314 | KJ930428 | Trogoderma sternale isolate der30 16S ribosomal RNA gene, partial sequence; mitochondrial | 383 | 89.7% | 258.186 | 6.49e-64 | 83.8% |
| 315 | GU356748 | Bathysciella jeanneli 16S ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 362 | 84.8% | 244.31 | 9.76e-60 | 83.8% |
| 316 | JN814893 | Enochrus bicolor isolate IBE-AB286 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 240.346 | 1.52e-58 | 83.7% |
| 317 | JN814903 | Enochrus bicolor isolate IBE-AB43 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 240.346 | 1.52e-58 | 83.7% |
| 318 | JN814904 | Enochrus bicolor isolate IBE-AB58 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 240.346 | 1.52e-58 | 83.7% |
| 319 | AY131467 | Monoplistes curvipes 16S ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 244.31 | 9.76e-60 | 83.6% |
| 320 | OP388437 | Chalcophora japonica mitochondrion, complete genome | 227 | 53.2% | 149.162 | 4.29e-31 | 83.5% |
| 321 | MZ571642 | Trogoderma sp. 3 MJB-2021a large subunit ribosomal RNA gene, partial sequence; mitochondrial | 417 | 97.7% | 262.151 | 4.16e-65 | 83.3% |
| 322 | KY765550 | Semanotus bifasciatus mitochondrion, partial genome | 402 | 94.1% | 258.186 | 6.49e-64 | 83.3% |
| 323 | MT012204 | Cafius mutatus isolate Monterey, California, USA large subunit ribosomal RNA gene, partial sequence; mitochondrial | 374 | 87.6% | 238.364 | 6.02e-58 | 83.3% |
| 324 | AY131447 | Canthonosoma castelnaui 16S ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 236.381 | 2.38e-57 | 83.3% |
| 325 | KF755232 | Enochrus coarctatus voucher IBE| 359 |
84.1% |
230.435 |
1.47e-55 |
83.3% |
|
| 326 | KC992697 | Oocyclus sapphirus 16S ribosomal RNA gene, partial sequence | 367 | 85.9% | 230.435 | 1.47e-55 | 83.3% |
| 327 | JX536482 | Typhloponemys sp. ZMUN 10029226 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 344 | 80.6% | 218.541 | 5.58e-52 | 83.3% |
| 328 | KF755267 | Enochrus politus voucher IBE| 257 |
60.2% |
161.055 |
1.13e-34 |
83.3% |
|
| 329 | LT905426 | Enochrus melanocephalus mitochondrion genomic DNA containing rrnL-trnL-nad14 region, specimen voucher NHM-2 | 257 | 60.2% | 161.055 | 1.13e-34 | 83.3% |
| 330 | MH317857 | Oocyclus meridensis isolate SLE0038 16S ribosomal RNA gene, partial sequence; mitochondrial | 368 | 86.2% | 232.417 | 3.71e-56 | 83.2% |
| 331 | LC075187 | Phelotrupes formosanus mitochondrial gene for 16S ribosomal RNA, partial sequence, specimen_voucher: NCHU:Geo01 | 367 | 85.9% | 230.435 | 1.47e-55 | 83.2% |
| 332 | HG915710 | Troglodromus bucheti mitochondrial 16S rRNA gene (partial), tRNA-Leu gene and NAD1 gene (partial), specimen voucher IBE| 362 |
84.8% |
228.452 |
5.80e-55 |
83.2% |
|
| 333 | HQ619674 | Colotes punctatus voucher UPOL001171 16S ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 228.452 | 5.80e-55 | 83.2% |
| 334 | MN473108 | Dynamostes audax mitochondrion, partial genome | 358 | 83.8% | 224.488 | 9.05e-54 | 83.2% |
| 335 | JN814895 | Enochrus segmentinotatus isolate IBE-AB288 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 224.488 | 9.05e-54 | 83.2% |
| 336 | HE576690 | Phacomorphus sioberi mitochondrial 16S rRNA gene (partial), tRNA-Leu gene and nad1 gene (partial), specimen voucher IBE:AF27 | 362 | 84.8% | 220.523 | 1.41e-52 | 83.1% |
| 337 | MZ571657 | Dermestidae sp. VAITC9100 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 346 | 81.0% | 216.559 | 2.21e-51 | 83.1% |
| 338 | NC_063826 | Anthrenus museorum mitochondrion, complete genome | 403 | 94.4% | 240.346 | 1.52e-58 | 83.0% |
| 339 | KX087239 | Anthrenus verbasci mitochondrion, partial genome | 403 | 94.4% | 240.346 | 1.52e-58 | 83.0% |
| 340 | JN581737 | Lomechusa pubicollis voucher ZMUN:10030917 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 373 | 87.4% | 226.47 | 2.29e-54 | 83.0% |
| 341 | HE663533 | Quaestus pasensis mitochondrial 16S rRNA gene (partial), tRNA-Leu gene and nad1 gene (partial), specimen voucher IBE-AC97 | 362 | 84.8% | 220.523 | 1.41e-52 | 83.0% |
| 342 | MZ571644 | Anthrenus verbasci voucher VAITC9639 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 407 | 95.3% | 240.346 | 1.52e-58 | 82.9% |
| 343 | AM419762 | Stygiophyes sanctigervasi mitochondrial partial 16S rRNA gene | 374 | 87.6% | 228.452 | 5.80e-55 | 82.9% |
| 344 | OW052253 | Philonthus cognatus genome assembly, organelle: mitochondrion | 367 | 85.9% | 222.506 | 3.58e-53 | 82.9% |
| 345 | JX536418 | Alisalia sp. ZMUN 10029195 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 365 | 85.5% | 222.506 | 3.58e-53 | 82.9% |
| 346 | JN814876 | Enochrus segmentinotatus isolate IBE-AB162 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 216.559 | 2.21e-51 | 82.9% |
| 347 | JN814891 | Enochrus segmentinotatus isolate IBE-AB274 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 216.559 | 2.21e-51 | 82.9% |
| 348 | EF213861 | Dermestes laniarius voucher 677524 16S ribosomal RNA gene, partial sequence; mitochondrial | 396 | 92.7% | 232.417 | 3.71e-56 | 82.8% |
| 349 | JF796475 | Cafius rufescens isolate CNUIC-113 16S ribosomal RNA gene, partial sequence; mitochondrial | 375 | 87.8% | 224.488 | 9.05e-54 | 82.8% |
| 350 | OM502092 | Larainae sp. voucher IBSAS-FZ0989 16S ribosomal RNA gene, partial sequence; mitochondrial | 375 | 87.8% | 218.541 | 5.58e-52 | 82.8% |
| 351 | KF755227 | Enochrus ater voucher IBE| 360 |
84.3% |
216.559 |
2.21e-51 |
82.8% |
|
| 352 | KF755221 | Enochrus ater voucher IBE| 360 |
84.3% |
216.559 |
2.21e-51 |
82.8% |
|
| 353 | KF755280 | Enochrus (Methydrus) sp. IBE-AB55 voucher IBE| 359 |
84.1% |
216.559 |
2.21e-51 |
82.8% |
|
| 354 | JN814885 | Enochrus ater isolate IBE-AB235 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 216.559 | 2.21e-51 | 82.8% |
| 355 | KF755223 | Enochrus ater voucher IBE| 360 |
84.3% |
216.559 |
2.21e-51 |
82.8% |
|
| 356 | AY131520 | Macroderes sp. dgi1 16S ribosomal RNA gene, partial sequence; mitochondrial | 360 | 84.3% | 214.576 | 8.72e-51 | 82.8% |
| 357 | KT303650 | Trochalus vagus voucher ZFMK:COL:DA0476 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 216.559 | 2.21e-51 | 82.7% |
| 358 | LN849380 | Speonomites nitens genomic DNA containing rrnL-trnL-nad1 region, specimen voucher NHM-IRC5 | 362 | 84.8% | 212.594 | 3.44e-50 | 82.7% |
| 359 | KF755282 | Enochrus testaceus voucher IBE| 360 |
84.3% |
208.63 |
5.38e-49 |
82.7% |
|
| 360 | MT904662 | Onthophagus cervus isolate G32 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 349 | 81.7% | 200.701 | 1.31e-46 | 82.7% |
| 361 | EF213863 | Anthrenus scrophulariae voucher 677526 16S ribosomal RNA gene, partial sequence; mitochondrial | 396 | 92.7% | 224.488 | 9.05e-54 | 82.6% |
| 362 | KT303666 | Trochalus sp. DA0688 voucher ZFMK:COL:DA0688 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 222.506 | 3.58e-53 | 82.6% |
| 363 | KT304075 | Trochalus sp. DA1506 voucher ZFMK:COL:DA1506 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 220.523 | 1.41e-52 | 82.6% |
| 364 | KP682740 | Bruchidius incarnatus voucher BRU.I11 16S ribosomal RNA gene, partial sequence; mitochondrial | 366 | 85.7% | 212.594 | 3.44e-50 | 82.6% |
| 365 | JN814882 | Enochrus falcarius isolate IBE-AB23 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 208.63 | 5.38e-49 | 82.6% |
| 366 | AM287067 | Enochrus testaceus mitochondrial partial 16S rRNA gene | 360 | 84.3% | 208.63 | 5.38e-49 | 82.6% |
| 367 | KF755283 | Enochrus testaceus voucher IBE| 360 |
84.3% |
208.63 |
5.38e-49 |
82.6% |
|
| 368 | AY131521 | Ontherus diabolicus 16S ribosomal RNA gene, partial sequence; mitochondrial | 361 | 84.5% | 208.63 | 5.38e-49 | 82.6% |
| 369 | JN814900 | Enochrus testaceus isolate IBE-AB36 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 208.63 | 5.38e-49 | 82.6% |
| 370 | KF755284 | Enochrus testaceus voucher IBE| 360 |
84.3% |
208.63 |
5.38e-49 |
82.6% |
|
| 371 | KF755222 | Enochrus ater voucher IBE| 360 |
84.3% |
208.63 |
5.38e-49 |
82.6% |
|
| 372 | KF755281 | Enochrus testaceus voucher IBE| 360 |
84.3% |
208.63 |
5.38e-49 |
82.6% |
|
| 373 | JN814879 | Enochrus falcarius isolate IBE-AB223 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 360 | 84.3% | 208.63 | 5.38e-49 | 82.6% |
| 374 | OM502085 | Larainae sp. voucher IBSAS-FZ0988 16S ribosomal RNA gene, partial sequence; mitochondrial | 360 | 84.3% | 204.665 | 8.39e-48 | 82.6% |
| 375 | JN581735 | Lomechusa emarginata voucher ZMUN:10030941 16S ribosomal RNA gene, partial sequence; tRNA-Leu (trnL) gene, complete sequence; and NADH dehydrogenase subunit 1 (NADH1) gene, partial cds; mitochondrial | 371 | 86.9% | 208.63 | 5.38e-49 | 82.5% |
| 376 | JN814883 | Enochrus segmentinotatus isolate IBE-AB231 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 353 | 82.7% | 202.683 | 3.32e-47 | 82.5% |
| 377 | KJ721867 | Onthophagus bivertex voucher c.s.syu201312 16S ribosomal RNA gene, partial sequence; mitochondrial | 350 | 82.0% | 202.683 | 3.32e-47 | 82.5% |
| 378 | KF755226 | Enochrus ater voucher IBE| 352 |
82.4% |
200.701 |
1.31e-46 |
82.5% |
|
| 379 | JF796483 | Cafius vestitus isolate CNUIC-121 16S ribosomal RNA gene, partial sequence; mitochondrial | 415 | 97.2% | 232.417 | 3.71e-56 | 82.4% |
| 380 | KY495973 | Mimaenictus wilsoni 16S ribosomal RNA gene, partial sequence; mitochondrial | 399 | 93.4% | 224.488 | 9.05e-54 | 82.4% |
| 381 | KT304170 | Trochalus sp. DA1559 voucher ZFMK:COL:DA1559 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 214.576 | 8.72e-51 | 82.4% |
| 382 | KT303875 | Trochalus sp. DA1499 voucher ZFMK:COL:DA1499 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 208.63 | 5.38e-49 | 82.4% |
| 383 | JF796459 | Cafius algarum isolate CNUIC-97 16S ribosomal RNA gene, partial sequence; mitochondrial | 366 | 85.7% | 206.647 | 2.12e-48 | 82.4% |
| 384 | AY131524 | Sarophorus tuberculatus 16S ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 202.683 | 3.32e-47 | 82.4% |
| 385 | KY495956 | Dorylotyphlus sp. JP-2017 16S ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 190.789 | 1.26e-43 | 82.4% |
| 386 | JN814906 | Enochrus natalensis isolate IBE-AB60 16S ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 333 | 78.0% | 186.825 | 1.97e-42 | 82.4% |
| 387 | KT780650 | Gyrohypnus fracticornis mitochondrion | 367 | 85.9% | 200.701 | 1.31e-46 | 82.3% |
| 388 | KF755285 | Enochrus cf. turanicus IBE-RA194 voucher IBE| 360 |
84.3% |
200.701 |
1.31e-46 |
82.3% |
|
| 389 | KC992696 | Oocyclus pico 16S ribosomal RNA gene, partial sequence | 368 | 86.2% | 200.701 | 1.31e-46 | 82.3% |
| 390 | MH317849 | Oocyclus coromoto isolate SLE0420 16S ribosomal RNA gene, partial sequence; mitochondrial | 368 | 86.2% | 200.701 | 1.31e-46 | 82.3% |
| 391 | AY131568 | Onthophagus babirussoides 16S ribosomal RNA gene, partial sequence; mitochondrial | 350 | 82.0% | 196.736 | 2.05e-45 | 82.3% |
| 392 | KU739480 | Onthophagus nr. babirussa mitochondrion, partial genome | 350 | 82.0% | 196.736 | 2.05e-45 | 82.3% |
| 393 | FJ903703 | Formicomus pedestris voucher UPOL ZL0051 16S ribosomal RNA gene, partial sequence; mitochondrial | 397 | 93.0% | 208.63 | 5.38e-49 | 82.2% |
| 394 | KT303716 | Trochalus sp. DA4129 voucher ZFMK:COL:DA4129 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 200.701 | 1.31e-46 | 82.2% |
| 395 | KF755224 | Enochrus ater voucher IBE| 341 |
79.9% |
190.789 |
1.26e-43 |
82.2% |
|
| 396 | OL757368 | Uloma metogana voucher Um002 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 188.807 | 4.99e-43 | 82.2% |
| 397 | OL757369 | Uloma metogana voucher Um004 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 188.807 | 4.99e-43 | 82.2% |
| 398 | OL757367 | Uloma metogana voucher Um001 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 188.807 | 4.99e-43 | 82.2% |
| 399 | OL757370 | Uloma metogana voucher Um003 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 188.807 | 4.99e-43 | 82.2% |
| 400 | KY495942 | Aenictosymbia cornuta 16S ribosomal RNA gene, partial sequence; mitochondrial | 399 | 93.4% | 216.559 | 2.21e-51 | 82.1% |
| 401 | KY495941 | Aenictophila sp. JP-2017 16S ribosomal RNA gene, partial sequence; mitochondrial | 374 | 87.6% | 198.718 | 5.18e-46 | 82.1% |
| 402 | JF796464 | Cafius caribeanus isolate CNUIC-102 16S ribosomal RNA gene, partial sequence; mitochondrial | 366 | 85.7% | 198.718 | 5.18e-46 | 82.1% |
| 403 | AJ231143 | Timarcha granadensis mitochondrial 16S rRNA gene, partial | 360 | 84.3% | 194.754 | 8.08e-45 | 82.1% |
| 404 | EF487821 | Aphodius ghardimaouensis 16S ribosomal RNA gene, partial sequence | 367 | 85.9% | 194.754 | 8.08e-45 | 82.1% |
| 405 | KF755248 | Enochrus halophilus voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.1% |
|
| 406 | KF755253 | Enochrus halophilus voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.1% |
|
| 407 | KC992668 | Enochrus fimbriatus 16S ribosomal RNA gene, partial sequence | 360 | 84.3% | 192.772 | 3.19e-44 | 82.1% |
| 408 | KF755250 | Enochrus halophilus voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.1% |
|
| 409 | KF755251 | Enochrus halophilus voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.1% |
|
| 410 | KY495990 | Weissflogia rhopalogaster 16S ribosomal RNA gene, partial sequence; mitochondrial | 399 | 93.4% | 208.63 | 5.38e-49 | 82.0% |
| 411 | DQ202590 | Notoxus monocerus voucher BMNH:679270 16S ribosomal RNA gene, partial sequence; mitochondrial | 378 | 88.5% | 196.736 | 2.05e-45 | 82.0% |
| 412 | JX994045 | Cotinis mutabilis 16S ribosomal RNA gene, partial sequence; mitochondrial | 367 | 85.9% | 194.754 | 8.08e-45 | 82.0% |
| 413 | KF755240 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.0% |
|
| 414 | KF755239 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.0% |
|
| 415 | KF755243 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.0% |
|
| 416 | LT905413 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad1 region, specimen voucher IBE-AN352 | 360 | 84.3% | 192.772 | 3.19e-44 | 82.0% |
| 417 | MK863492 | Canthon cyanellus voucher Col1H large subunit ribosomal RNA gene, partial sequence; mitochondrial | 361 | 84.5% | 192.772 | 3.19e-44 | 82.0% |
| 418 | KF755242 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.0% |
|
| 419 | LT905431 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad19 region, specimen voucher IBE-AB239 | 360 | 84.3% | 192.772 | 3.19e-44 | 82.0% |
| 420 | KF755269 | Enochrus politus voucher IBE| 360 |
84.3% |
192.772 |
3.19e-44 |
82.0% |
|
| 421 | MG017450 | Anthrenus verbasci mitochondrion, partial genome | 417 | 97.7% | 218.541 | 5.58e-52 | 81.9% |
| 422 | EF487907 | Trochalus sp. BMNH 671429 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 377 | 88.3% | 198.718 | 5.18e-46 | 81.9% |
| 423 | EF656648 | Canthon lamprimus voucher BMNH:668671 16S ribosomal RNA gene, partial sequence; mitochondrial | 361 | 84.5% | 192.772 | 3.19e-44 | 81.9% |
| 424 | JF796481 | Cafius sulcicollis isolate CNUIC-119 16S ribosomal RNA gene, partial sequence; mitochondrial | 374 | 87.6% | 190.789 | 1.26e-43 | 81.9% |
| 425 | MT012202 | Cafius bisulcatus isolate Coquimbo, Chile large subunit ribosomal RNA gene, partial sequence; mitochondrial | 374 | 87.6% | 190.789 | 1.26e-43 | 81.9% |
| 426 | AB285560 | Nicrophorus japonicus mitochondrial gene for 16S ribosomal RNA, partial sequence | 361 | 84.5% | 186.825 | 1.97e-42 | 81.9% |
| 427 | MH789722 | Anthicidae sp. 1 ACP-2013 mitochondrion | 427 | 100.0% | 214.576 | 8.72e-51 | 81.8% |
| 428 | KF625954 | Lampyridae sp. UPOL RK0378 16S ribosomal RNA gene, partial sequence; mitochondrial | 401 | 93.9% | 200.701 | 1.31e-46 | 81.8% |
| 429 | AB436506 | Drilaster axillaris mitochondrial gene for 16S rRNA, partial sequence, isolate: 07706A_a | 401 | 93.9% | 200.701 | 1.31e-46 | 81.8% |
| 430 | NC_072265 | Callimerus chinensis mitochondrion, complete genome | 377 | 88.3% | 196.736 | 2.05e-45 | 81.8% |
| 431 | PP209352 | Wagnerinus harmandi isolate Wharm_J1 mitochondrion, complete genome | 367 | 85.9% | 190.789 | 1.26e-43 | 81.8% |
| 432 | AJ622029 | Timarcha erosa vermiculata mitochondrial partial 16S rRNA gene, country Portugal:Porto Alto, Santarem | 360 | 84.3% | 186.825 | 1.97e-42 | 81.8% |
| 433 | LT905424 | Enochrus (Lumetus) hamifer mitochondrion genomic DNA containing rrnL-trnL-nad12 region, specimen voucher IBE-SP2 | 360 | 84.3% | 186.825 | 1.97e-42 | 81.8% |
| 434 | AJ231145 | Timarcha insparsa mitochondrial 16S rRNA gene, partial | 360 | 84.3% | 186.825 | 1.97e-42 | 81.8% |
| 435 | LT905425 | Enochrus melanocephalus mitochondrion genomic DNA containing rrnL-trnL-nad13 region, specimen voucher NHM-1 | 360 | 84.3% | 184.843 | 7.78e-42 | 81.8% |
| 436 | KF755256 | Enochrus hamiltoni voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.8% |
|
| 437 | LT905428 | Enochrus (Lumetus) politus mitochondrion genomic DNA containing rrnL-trnL-nad16 region, specimen voucher IBE-AB264 | 360 | 84.3% | 184.843 | 7.78e-42 | 81.8% |
| 438 | AJ236382 | Timarcha hispanica mitochondrial 16S rRNA gene (partial), isolate Sao Torpes beach, Alentejo, Portugal | 360 | 84.3% | 184.843 | 7.78e-42 | 81.8% |
| 439 | KF755255 | Enochrus hamifer voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.8% |
|
| 440 | KC992667 | Enochrus cinctus 16S ribosomal RNA gene, partial sequence | 360 | 84.3% | 184.843 | 7.78e-42 | 81.8% |
| 441 | KF755265 | Enochrus politus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.8% |
|
| 442 | KF755266 | Enochrus politus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.8% |
|
| 443 | KF755268 | Enochrus politus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.8% |
|
| 444 | KF755254 | Enochrus halophilus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.8% |
|
| 445 | MT113338 | Attagenus unicolor japonicus mitochondrion, complete genome | 417 | 97.7% | 210.612 | 1.36e-49 | 81.7% |
| 446 | FJ903712 | Anthicidae sp. UPOL ZL0063 16S ribosomal RNA gene, partial sequence; mitochondrial | 399 | 93.4% | 198.718 | 5.18e-46 | 81.7% |
| 447 | KF755245 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 448 | KF755234 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 449 | KF755236 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 450 | KF755264 | Enochrus politus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 451 | KF755244 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 452 | KF755238 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 453 | KF755246 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 454 | KF755235 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 455 | KF755271 | Enochrus politus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 456 | KF755273 | Enochrus quadripunctatus voucher IBE| 360 |
84.3% |
184.843 |
7.78e-42 |
81.7% |
|
| 457 | AM287068 | Enochrus quadripunctatus mitochondrial partial 16S rRNA gene | 360 | 84.3% | 184.843 | 7.78e-42 | 81.7% |
| 458 | KF755270 | Enochrus politus voucher IBE| 359 |
84.1% |
182.86 |
3.07e-41 |
81.7% |
|
| 459 | AB285561 | Nicrophorus tomentosus mitochondrial gene for 16S ribosomal RNA, partial sequence | 361 | 84.5% | 178.896 | 4.80e-40 | 81.7% |
| 460 | EU162539 | Onthophagus coscineus 16S ribosomal RNA gene, partial sequence; mitochondrial | 350 | 82.0% | 178.896 | 4.80e-40 | 81.7% |
| 461 | AB009927 | Drilaster axillaris mitochondrial DNA for 16S rRNA, partial sequence | 401 | 93.9% | 192.772 | 3.19e-44 | 81.6% |
| 462 | AJ231139 | Timarcha cyanescens mitochondrial 16S rRNA gene, partial | 360 | 84.3% | 186.825 | 1.97e-42 | 81.6% |
| 463 | OY720324 | Philonthus spinipes genome assembly, organelle: mitochondrion | 376 | 88.1% | 184.843 | 7.78e-42 | 81.6% |
| 464 | EF487880 | Trochalus sp. BMNH 671433 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 367 | 85.9% | 184.843 | 7.78e-42 | 81.6% |
| 465 | LT905432 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad20 region, specimen voucher IBE-SP3 | 360 | 84.3% | 184.843 | 7.78e-42 | 81.6% |
| 466 | MZ342781 | Pelecyphorus foveolatus mitochondrion, complete genome | 365 | 85.5% | 180.878 | 1.21e-40 | 81.6% |
| 467 | KC992698 | Oocyclus sp. SLE0085 16S ribosomal RNA gene, partial sequence | 365 | 85.5% | 178.896 | 4.80e-40 | 81.6% |
| 468 | KJ510121 | Uloma opacipennis voucher LSOL.02236 16S ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 168.984 | 4.62e-37 | 81.6% |
| 469 | OP235946 | Attagenus unicolor japonicus mitochondrion, complete genome | 417 | 97.7% | 202.683 | 3.32e-47 | 81.5% |
| 470 | KF755233 | Enochrus diffusus voucher IBE| 360 |
84.3% |
176.913 |
1.90e-39 |
81.5% |
|
| 471 | LT905422 | Enochrus (Lumetus) hamifer mitochondrion genomic DNA containing rrnL-trnL-nad10 region, specimen voucher IBE-AN453 | 360 | 84.3% | 176.913 | 1.90e-39 | 81.5% |
| 472 | DQ202576 | Enochrus testaceus voucher BMNH:679133 16S ribosomal RNA gene, partial sequence; mitochondrial | 360 | 84.3% | 176.913 | 1.90e-39 | 81.5% |
| 473 | KF755263 | Enochrus nigritus voucher IBE| 360 |
84.3% |
174.931 |
7.49e-39 |
81.5% |
|
| 474 | MF974978 | Dicranosterna immaculata voucher 196156 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 371 | 86.9% | 182.86 | 3.07e-41 | 81.4% |
| 475 | MF974979 | Dicranosterna immaculata voucher 196157 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 371 | 86.9% | 182.86 | 3.07e-41 | 81.4% |
| 476 | LT905433 | Enochrus (Lumetus) fuscipennis mitochondrion genomic DNA containing rrnL-trnL-nad21 region, specimen voucher IBE-SP5 | 360 | 84.3% | 178.896 | 4.80e-40 | 81.4% |
| 477 | EF487927 | Lamproserica sp. BMNH 671446 16S large subunit ribosomal RNA gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 367 | 85.9% | 176.913 | 1.90e-39 | 81.3% |
| 478 | KT303800 | Mesoserica transvaalensis voucher BMNH:835127 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 172.949 | 2.96e-38 | 81.3% |
| 479 | KJ510119 | Uloma opacipennis voucher LSOL.02224 16S ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 161.055 | 1.13e-34 | 81.3% |
| 480 | KJ003069 | Uloma opacipennis 16S ribosomal RNA gene, partial sequence; mitochondrial | 344 | 80.6% | 161.055 | 1.13e-34 | 81.3% |
| 481 | AB127077 | Ctenolepisma villosa mitochondrial gene for 16S rRNA, partial sequence, country:Japan:Fukuoka, Hakata | 417 | 97.7% | 194.754 | 8.08e-45 | 81.2% |
| 482 | JF796471 | Cafius mimulus isolate CNUIC-109 16S ribosomal RNA gene, partial sequence; mitochondrial | 416 | 97.4% | 192.772 | 3.19e-44 | 81.2% |
| 483 | OQ716385 | Sirocalodes nigroterminatus voucher LG443xMEV0564 mitochondrion, partial genome | 377 | 88.3% | 176.913 | 1.90e-39 | 81.2% |
| 484 | KP143586 | Epilachna sp. KS155 16S ribosomal RNA gene, partial sequence; mitochondrial | 376 | 88.1% | 176.913 | 1.90e-39 | 81.2% |
| 485 | MF974935 | Calomela ioptera voucher JAJ12 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 371 | 86.9% | 176.913 | 1.90e-39 | 81.2% |
| 486 | MH433171 | Sirocalodes nigroterminatus voucher ZFMK:TIS-3034 16S ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 176.913 | 1.90e-39 | 81.2% |
| 487 | MF975061 | Peltoschema sp. WA5 voucher JAJ159 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 361 | 84.5% | 170.967 | 1.17e-37 | 81.2% |
| 488 | FJ903731 | Rhipiphoridae sp. UPOL ZL0100 16S ribosomal RNA gene, partial sequence; mitochondrial | 368 | 86.2% | 167.002 | 1.83e-36 | 81.2% |
| 489 | KF755274 | Enochrus quadripunctatus voucher IBE| 360 |
84.3% |
168.984 |
4.62e-37 |
81.1% |
|
| 490 | KF755247 | Enochrus fuscipennis voucher IBE| 360 |
84.3% |
168.984 |
4.62e-37 |
81.1% |
|
| 491 | AJ781541 | Rhabdopterus praetextus partial 16S rRNA gene | 367 | 85.9% | 167.002 | 1.83e-36 | 81.1% |
| 492 | KT304021 | Glaphyserica humeralis voucher ZFMK:COL:DA4302 16S large subunit ribosomal RNA gene, partial sequence; mitochondrial | 377 | 88.3% | 167.002 | 1.83e-36 | 81.1% |
| 493 | KX035193 | Scolytinae sp. BMNH 1040351 mitochondrion, complete genome | 367 | 85.9% | 165.02 | 7.22e-36 | 81.1% |
| 494 | LT905447 | Enochrus (Lumetus) turanicus mitochondrion genomic DNA containing rrnL-trnL-nad35 region, specimen voucher IBE-SP6 | 360 | 84.3% | 165.02 | 7.22e-36 | 81.0% |
| 495 | MH433128 | Mogulones dimidiatus voucher ZFMK:TIS-3644 16S ribosomal RNA gene, partial sequence; mitochondrial | 411 | 96.3% | 180.878 | 1.21e-40 | 80.9% |
| 496 | MH433131 | Mogulones geographicus voucher ZFMK:TIS-3564 16S ribosomal RNA gene, partial sequence; mitochondrial | 411 | 96.3% | 172.949 | 2.96e-38 | 80.7% |
| 497 | MF975050 | Peltoschema scutiferum voucher JAJ150 large subunit ribosomal RNA gene, partial sequence; mitochondrial | 361 | 84.5% | 157.091 | 1.76e-33 | 80.7% |
| 498 | HQ711584 | Amorphochelus sp. MA3 16S large subunit ribosomal RNA (rrnL) gene, partial sequence; tRNA-Leu gene, complete sequence; and NADH dehydrogenase subunit 1 (ND1) gene, partial cds; mitochondrial | 367 | 85.9% | 151.144 | 1.08e-31 | 80.7% |
| 499 | AJ781538 | Percolaspis nr. gestroi JGZ-2004 partial 16S rRNA gene | 377 | 88.3% | 153.126 | 2.75e-32 | 80.5% |
| 500 | KP682969 | Amblycerus caymanensis 16S ribosomal RNA gene, partial sequence; mitochondrial | 411 | 96.3% | 167.002 | 1.83e-36 | 80.4% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Trogoderma granarium | species | Trogoderma granarium | Trogoderma granarium | MZ571637 | 1.0 |
Database coverage of Taxon of Interest Trogoderma granariumThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Trogoderma granarium
Flag 5.1C:
The reference data are likely to be unreliable for this species
0 records
There are 0 sequences in the reference database for Trogoderma granarium at the given locus 16S mitochondrial rRNA gene.
Global occurrence records for Trogoderma granarium.
Database coverage of species in genus Trogoderma
Flag 5.2C:
The reference data offers little support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 16S mitochondrial rRNA gene Database coverage of species in genus Trogoderma that occur in country of origin Pakistan
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 16S mitochondrial rRNA gene |
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent sources
Flag 4A:
Reference sequences are from diverse sources and therefore likely to be reliable
Reasoning: Matching sequence records for this species are from >5 independent sources
(found 6 sources)
6 Independent Sources
The matching reference sequences for this species have been annotated by 6 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| MZ571637 | False |
Rako,L. Agarwal,A. Semeraro,L. Broadley,A. Rodoni,B.C. Blacket,M.J. |
A LAMP (loop-mediated isothermal amplification) test for rapid identification of Khapra beetle (Trogoderma granarium) | Pest Manag Sci (2021) In press |
| MZ571637 | False |
Blacket,M. Rako,L. Agarwal,A. |
Direct Submission | Submitted (13-JUL-2021) AVR, Agriculture Victoria, AgriBio, Bundoora, Victoria 3083, Australia |
| MZ571636 | False |
Rako,L. Agarwal,A. Semeraro,L. Broadley,A. Rodoni,B.C. Blacket,M.J. |
A LAMP (loop-mediated isothermal amplification) test for rapid identification of Khapra beetle (Trogoderma granarium) | Pest Manag Sci (2021) In press |
| MZ571636 | False |
Blacket,M. Rako,L. Agarwal,A. |
Direct Submission | Submitted (13-JUL-2021) AVR, Agriculture Victoria, AgriBio, Bundoora, Victoria 3083, Australia |
| Show Hide 2 more publications... | ||||
Source 2
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| KJ930431 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Molecular identification of Trogoderma granarium (Coleoptera: Dermestidae) using the 16S gene | Unpublished |
| KJ930431 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Direct Submission | Submitted (02-JUN-2014) Center for Learning Innovation, University of Minnesota, Rochester, 111 South Broadway Suite 300, Rochester, MN 55904, USA |
| KJ930432 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Molecular identification of Trogoderma granarium (Coleoptera: Dermestidae) using the 16S gene | Unpublished |
| KJ930432 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Direct Submission | Submitted (02-JUN-2014) Center for Learning Innovation, University of Minnesota, Rochester, 111 South Broadway Suite 300, Rochester, MN 55904, USA |
| KJ930452 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Molecular identification of Trogoderma granarium (Coleoptera: Dermestidae) using the 16S gene | Unpublished |
| KJ930452 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Direct Submission | Submitted (02-JUN-2014) Center for Learning Innovation, University of Minnesota, Rochester, 111 South Broadway Suite 300, Rochester, MN 55904, USA |
| KJ930433 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Molecular identification of Trogoderma granarium (Coleoptera: Dermestidae) using the 16S gene | Unpublished |
| KJ930433 | False |
Olson,R.L.O. Farris,R.E. Barr,N.B. Cognato,A.I. |
Direct Submission | Submitted (02-JUN-2014) Center for Learning Innovation, University of Minnesota, Rochester, 111 South Broadway Suite 300, Rochester, MN 55904, USA |
| Show Hide 6 more publications... | ||||
Source 3
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| OM388538 | False |
mzhr,N.N. Jawad,M.M. Sabr,A.J. |
Direct Submission | Submitted (25-JAN-2022) biology, Baghdad university, palestine street, baghdad, baghgdad 10046, Iraq |
| OM389182 | False |
mzhr,N.N. Jawad,M.M. Sabr,A.J. |
Direct Submission | Submitted (25-JAN-2022) biology, Baghdad university, palestine street, baghdad, baghgdad 10046, Iraq |
| OM388512 | False |
Mzhr,N.N. Jawad,M.M. Sabr,A.J. |
Direct Submission | Submitted (25-JAN-2022) biology, Baghdad university, palestine street, baghdad, baghgdad 10046, Iraq |
| OM388567 | False |
Mzhr,N.N. Jawad,M.M. Sabr,A.J. |
Direct Submission | Submitted (25-JAN-2022) biology, Baghdad university, palestine street, baghdad, baghgdad 10046, Iraq |
| OM389131 | False |
Mzhr,N.N. Jawad,M.M. Sabr,A.J. |
Direct Submission | Submitted (25-JAN-2022) biology, Baghdad university, palestine street, baghdad, baghgdad 10046, Iraq |
| Show Hide 3 more publications... | ||||
Source 4
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| LC386208 | False |
Furui,S. Miyanoshita,A. Imamura,T. Minegishi,Y. Kokutani,R. |
Qualitative real-time PCR identification of the khapra beetle, Trogoderma granarium (Coleoptera: Dermestidae) | Appl. Entomol. Zool. (Jpn.) 54, 101-107 (2019) |
| LC386208 | False |
Furui,S. Minegishi,Y. Kokutani,R. |
Direct Submission | Submitted (28-MAY-2018) Contact:Satoshi Furui Food Research Institute, NARO, Food Entomology Laboratory; 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan URL :http://www.naro.affrc.go.jp/english/index.html |
Source 5
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| ON725093 | False |
Kavallieratos,N.G. Boukouvala,M.C. Lorentha Gidari,D. Di Giuseppe,G. Canale,A. Benelli,G. |
Does cross-mating affect behavioral asymmetries and mating success of Trogoderma granarium strains? | Unpublished |
| ON725093 | False | Di Giuseppe,G. | Direct Submission | Submitted (10-JUN-2022) Department of Biology, University of Pisa, Italy, Via A. Volta, 4, Pisa, PI I-56126, Italy |
Source 6
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| NC_053875 | False |
Zeng,L. Pang,Y. Feng,S. Wang,Y. Stejskal,V. Aulicky,R. Zhang,S. Li,Z. |
Comparative mitochondrial genomics of five Dermestid beetles (Coleoptera: Dermestidae) and its implications for phylogeny | Genomics (2020) In press |
| NC_053875 | False | Direct Submission | Submitted (25-MAR-2021) National Center for Biotechnology Information, NIH, Bethesda, MD 20894, USA | |
| NC_053875 | False |
Zeng,L. Pang,Y. Li,Z. |
Direct Submission | Submitted (25-FEB-2020) Department of Entomology, College of Plant Protection, China Agricultural University, Yuanmingyuan West Road 2#, Haidian District, Beijing 100193, China |
| Show Hide 1 more publication... | ||||
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |